circad | circRNAs associated with diseases

Hsa_circ_0008274
Gene	UGGT2	Organism	Human
Genome Locus	chr11: 96485180-96489456:n/a	Build	hg19
Disease	Papillary Thyroid Carcinoma	ICD-10	#N/A (D09.3)
DBLink	Link to database	PMID	28288173
Experimental Method
Sample Type	Tissue and cell lines	Comparison	8 thyroid samples, consisting of six PTC tumors, six matching contralateral normal samples, and six benign thyroid lesions
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGGGTGGAGTATGATGCTGA Reverse -CACACCAGGTTTCACACCAC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Peng, N, Shi, L, Zhang, Q, Hu, Y, Wang, N, Ye, H (2017). Microarray profiling of circular RNAs in human papillary thyroid carcinoma. PLoS ONE, 12, 3:e0170287.